ccdc151

Ensembl ID:
ENSDARG00000062978
ZFIN ID:
ZDB-GENE-061013-787
Description:
coiled-coil domain containing 151-like [Source:RefSeq peptide;Acc:NP_001070837]
Human Orthologue:
CCDC151
Human Description:
coiled-coil domain containing 151 [Source:HGNC Symbol;Acc:28303]
Mouse Orthologue:
Ccdc151
Mouse Description:
coiled-coil domain containing 151 Gene [Source:MGI Symbol;Acc:MGI:1924859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14784 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091628 Essential Splice Site 92 545 3 13
Genomic Location:
Chromosome 6 (position 9532288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGGCYATGGTGTGGAGAAAGCACCATTCAGGAACATGCCTGTGAAGG[T/A]ATTATTGTTATRATCAGATCACGTGAYTGAAAATTTATTNATAAACACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yd2q390r