iffo1

Ensembl ID:
ENSDARG00000062976
ZFIN ID:
ZDB-GENE-060503-418
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L938]
Human Orthologue:
IFFO1
Human Description:
intermediate filament family orphan 1 [Source:HGNC Symbol;Acc:24970]
Mouse Orthologue:
Iffo1
Mouse Description:
intermediate filament family orphan 1 Gene [Source:MGI Symbol;Acc:MGI:2444516]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36786 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091615 Nonsense 436 651 5 9
ENSDART00000134841 Nonsense 423 586 5 8
Genomic Location (Zv9):
Chromosome 19 (position 10109025)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9567564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTCTAGCAAGTAGCCACACCTCCGTCAACCCTGACTCGTCGTCCT[C/T]GAAAACCAGCCCCGCAGACCATCAGAGGCAACGACAGCGATGAGCCAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link