hip1

Ensembl ID:
ENSDARG00000062972
ZFIN ID:
ZDB-GENE-010328-15
Description:
huntingtin-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001159677]
Human Orthologue:
HIP1
Human Description:
huntingtin interacting protein 1 [Source:HGNC Symbol;Acc:4913]
Mouse Orthologue:
Hip1
Mouse Description:
huntingtin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1099804]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13897 Essential Splice Site Available for shipment Available now
sa22608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014465 Essential Splice Site 398 1048 13 31
Genomic Location (Zv9):
Chromosome 15 (position 15985458)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17030421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGAGCTACAGGCCCTGAAAGAGGAGCTGGAGTCCTTTAGATTGGAGG[T/C]AAATTAAAAGATGGKGGAGGAGARCAGGTCAAATGTTATAATCGAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014465 Nonsense 1010 1048 30 31
Genomic Location (Zv9):
Chromosome 15 (position 15958641)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 17003604
KASP Assay ID:
2260-8270.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTGTGAACATATTTTGACCATTTCATGTGTGTCAGGTGTTGGTGT[T/A]GGAGCTAGAGACGCGGCTGCAGAAAGAGAGAGAGCGACTGGGTGAACTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link