hip1

Ensembl ID:
ENSDARG00000062972
ZFIN ID:
ZDB-GENE-010328-15
Description:
huntingtin-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001159677]
Human Orthologue:
HIP1
Human Description:
huntingtin interacting protein 1 [Source:HGNC Symbol;Acc:4913]
Mouse Orthologue:
Hip1
Mouse Description:
huntingtin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1099804]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13897 Essential Splice Site Available for shipment Available now
sa4599 Nonsense Mutation detected in F1 DNA During 2014
sa22608 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13897
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014465 Essential Splice Site 398 1048 13 31
Genomic Location:
Chromosome 15 (position 15985458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGAGCTACAGGCCCTGAAAGAGGAGCTGGAGTCCTTTAGATTGGAGG[T/C]AAATTAAAAGATGGKGGAGGAGARCAGGTCAAATGTTATAATCGAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014465 Nonsense 519 1048 16 31
Genomic Location:
Chromosome 15 (position 15981711)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCACAGGATGAGGTGGAGAATGTGAAGAAAGAGATGCAGGACAGATTA[A/T]AAGTCGCCCAGGACTCTGCCAGTCAGCAGGTTRGACACAAACCACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014465 Nonsense 1010 1048 30 31
Genomic Location:
Chromosome 15 (position 15958641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTCTGTGAACATATTTTGACCATTTCATGTGTGTCAGGTGTTGGTGT[T/A]GGAGCTAGAGACGCGGCTGCAGAAAGAGAGAGAGCGACTGGGTGAACTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ua0bxds9