fam129b

Ensembl ID:
ENSDARG00000062970
ZFIN ID:
ZDB-GENE-070112-1222
Description:
hypothetical protein LOC563073 [Source:RefSeq peptide;Acc:NP_001074055]
Human Orthologue:
FAM129B
Human Description:
family with sequence similarity 129, member B [Source:HGNC Symbol;Acc:25282]
Mouse Orthologue:
Fam129b
Mouse Description:
family with sequence similarity 129, member B Gene [Source:MGI Symbol;Acc:MGI:2442910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23887 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102197 Essential Splice Site 140 839 4 14
Genomic Location:
Chromosome 21 (position 12046105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGACCTCTATGGAAGAATACCTGGAGCTTCTCAATAGCAGCCTGAGTG[G/A]TGAGATGCACATTGAAATTATTTATATGCAAGTAAAGGCCCTTGCACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c82kl8pk