sbf1

Ensembl ID:
ENSDARG00000062968
ZFIN ID:
ZDB-GENE-040718-139
Description:
myotubularin-related protein 5 [Source:RefSeq peptide;Acc:NP_001038623]
Human Orthologue:
SBF1
Human Description:
SET binding factor 1 [Source:HGNC Symbol;Acc:10542]
Mouse Orthologue:
Sbf1
Mouse Description:
SET binding factor 1 Gene [Source:MGI Symbol;Acc:MGI:1925230]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26228 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38424 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33397 Nonsense Mutation detected in F1 DNA During 2017
sa20215 Nonsense Available for shipment Available now
sa1459 Essential Splice Site Available for shipment Available now
sa11843 Essential Splice Site Available for shipment Available now
sa33398 Nonsense Mutation detected in F1 DNA During 2017
sa25276 Nonsense Mutation detected in F1 DNA During 2017
sa1433 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Essential Splice Site 19 1850 1 40
ENSDART00000091601   None 1885 None 41
ENSDART00000109452 Essential Splice Site 19 1849 1 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 8973963)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9910811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCTCGCCGATTACTTCGTTGTAGTCGGCTACGATCTGGATAAGAGAGG[T/C]AAGAGTGAGACACAGCCAGCGATTCTTCCTCCTCCTCTTCCCCTCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Essential Splice Site 390 1850 11 40
ENSDART00000091601 Essential Splice Site 392 1885 11 41
ENSDART00000109452 Essential Splice Site 390 1849 11 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9024363)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9961211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCACATCATTCGCATCCACCCTGAACCCGTCATCCGCTTCCATAAG[G/A]TAATTAATACAGCCCTGAATACGATTTAACAGTAGAACCTATGATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Nonsense 443 1850 13 40
ENSDART00000091601 Nonsense 445 1885 13 41
ENSDART00000109452 Nonsense 443 1849 13 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9024861)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9961709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTCTTTATTTTCCTTTTAGCTCATAGCCAATCAGGTGGAGCGCATT[C/T]GAAAGGAGACTGGAGATCCTCATAAAGTCATGAAGCACATTAAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Nonsense 462 1850 13 40
ENSDART00000091601 Nonsense 464 1885 13 41
ENSDART00000109452 Nonsense 462 1849 13 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9024918)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9961766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTGGAGATCCTCATAAAGTCATGAAGCACATTAAGGAGCTGGCGGAG[C/T]AGCTTTTCAAAAATGTATGTCCGATTTGTGGGTCTTATATGAATATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Essential Splice Site 786 1850 19 40
ENSDART00000091601 Essential Splice Site 790 1885 19 41
ENSDART00000109452 Essential Splice Site 786 1849 19 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9031725)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9968573
KASP Assay ID:
554-1384.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGGCCTYGGGGACGTCGAGAGCGTCAGCAACAGCTACGTCACCAACAG[G/A]TTTGTGCGGGCTCGGACTGGGAGACAATAAAAAAAGCAAACATTTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Essential Splice Site 868 1850 21 40
ENSDART00000091601 Essential Splice Site 872 1885 21 41
ENSDART00000109452 Essential Splice Site 868 1849 21 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9037556)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9974404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGACGCGGTTCACAGGGAGAGCAAACGTCTGCCGCCCATCCAAAAGG[T/C]AACMAACTCATTGTTTTACGTTCCTCTGGGCAGGAAAGGCAGTGTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Nonsense 1117 1850 26 40
ENSDART00000091601 Nonsense 1120 1885 26 41
ENSDART00000109452 Nonsense 1116 1849 26 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9045578)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9982426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTCAAACCATGAGTAATGTGGTGGAGCGGGCCTGCTGTCGGGACTAC[C/T]AACGGTTGGGACTGGGCACGCTCAGTAACAGCCTGACCCGCTCCAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Nonsense 1699 1850 37 40
ENSDART00000091601 Nonsense 1734 1885 38 41
ENSDART00000109452 Nonsense 1698 1849 37 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9056049)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9992897
KASP Assay ID:
554-7485.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGATGTCCTCTAATCTGAGCCACCAGCGGCGCTCTCAGGGAGTCTA[T/A]CTGCAGGAGAGCGGCGTTGGCTCCTCCATCAATCTGGCTCTAGACTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091599 Nonsense 1829 1850 40 40
ENSDART00000091601 Nonsense 1864 1885 41 41
ENSDART00000109452 Nonsense 1828 1849 40 40

The following transcripts of ENSDARG00000062968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 9060465)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9997313
KASP Assay ID:
554-1361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTCTTCTCTTCCAGCTCAAGACGACCAAAAGAGTGTACAACTTCTG[T/A]GCCCAGGACAGCTCAAATGCGCAGTCATGGATGGACAGTATTCAGGGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link