mll4a

Ensembl ID:
ENSDARG00000062962
ZFIN ID:
ZDB-GENE-060503-376
Description:
Novel protein similar to vertebrate myeloid/lymphoid or mixed-lineage leukemia (Trithorax homolog, D
Human Orthologue:
AD000671.3
Human Description:
Histone-lysine N-methyltransferase MLL4 [Source:UniProtKB/Swiss-Prot;Acc:Q9UMN6]
Mouse Orthologue:
Wbp7
Mouse Description:
WW domain binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:109565]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23447 Nonsense Mutation detected in F1 DNA During 2014
sa7876 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15376 Nonsense Available for shipment Available now
sa23448 Essential Splice Site Available for shipment Available now
sa4788 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 629 2863 4 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Nonsense 637 801 4 7
Genomic Location:
Chromosome 19 (position 9867092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACTGAAACAAGTGCACAAAATGAGCAGCAAGGTGGTATCCCGCAG[C/T]GAATGAGTGTTTCCGGAGCCAATAGGAGGATGATCCACTTGTTGAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 664 2863 5 37
ENSDART00000136957 None None 1897 None 27
ENSDART00000147922 Essential Splice Site 672 801 5 7
Genomic Location:
Chromosome 19 (position 9868203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGCCACGTGRCTGTGTTGTTATACTTATGACGGTGATTATTCTGTGC[A/T]GCTTCTGTCTGGCWCTGTAAAAGCAAGAGAAGGACCAGCCACAGCTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 1017 2863 12 37
ENSDART00000136957 Nonsense 57 1897 2 27
ENSDART00000147922 None None 801 None 7
Genomic Location:
Chromosome 19 (position 9873986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCTTGAGTATTCTCACTTCAGTTCCCATCATGCCCCAGTGTGTTTG[T/A]CTGCTCTGTGCCAGCAAAGGCCAGCATGAGGTAAGATKCAACACYMTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Essential Splice Site 1343 2863 20 37
ENSDART00000136957 Essential Splice Site 382 1897 10 27
ENSDART00000147922 None None 801 None 7
Genomic Location:
Chromosome 19 (position 9878488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCAGGACCCCAAAACCTGGAGCTCAAATGTGCAAGAATTCCCACGG[T/C]ATGAACCACATTTTTCTTACTTTTCAATAATAAGGTATTCTTAGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091588 Nonsense 2429 2863 29 37
ENSDART00000136957 Nonsense 1463 1897 19 27
ENSDART00000147922 None None 801 None 7
Genomic Location:
Chromosome 19 (position 9889571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCATCAACTCTTCGTACTCAACCCAACATCTTGGCCAACTCTCGATCT[C/T]AAGTCAGAATCAAGAGAGTGTCCTCGGTAACTGAACGAATCGGTGTGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/87qb3lai