A3KNP9_DANRE

Ensembl ID:
ENSDARG00000062960
Description:
LOC557740 protein [Source:UniProtKB/TrEMBL;Acc:A3KNP9]
Human Orthologues:
ARMC10, ARMCX1, ARMCX2, ARMCX3, ARMCX4, ARMCX5, ARMCX6, BHLHB9, GPRASP1, GPRASP2
Human Descriptions:
armadillo repeat containing 10 [Source:HGNC Symbol;Acc:21706]
armadillo repeat containing, X-linked 1 [Source:HGNC Symbol;Acc:18073]
armadillo repeat containing, X-linked 2 [Source:HGNC Symbol;Acc:16869]
armadillo repeat containing, X-linked 3 [Source:HGNC Symbol;Acc:24065]
armadillo repeat containing, X-linked 4 [Source:HGNC Symbol;Acc:28615]
armadillo repeat containing, X-linked 5 [Source:HGNC Symbol;Acc:25772]
armadillo repeat containing, X-linked 6 [Source:HGNC Symbol;Acc:26094]
basic helix-loop-helix domain containing, class B, 9 [Source:HGNC Symbol;Acc:29353]
G protein-coupled receptor associated sorting protein 1 [Source:HGNC Symbol;Acc:24834]
G protein-coupled receptor associated sorting protein 2 [Source:HGNC Symbol;Acc:25169]
Mouse Orthologues:
Armc10, Armcx1, Armcx2, Armcx3, Armcx5, Armcx6, Bhlhb9, Gprasp1, Gprasp2
Mouse Descriptions:
armadillo repeat containing 10 Gene [Source:MGI Symbol;Acc:MGI:1914461]
armadillo repeat containing, X-linked 1 Gene [Source:MGI Symbol;Acc:MGI:1925498]
armadillo repeat containing, X-linked 2 Gene [Source:MGI Symbol;Acc:MGI:1914666]
armadillo repeat containing, X-linked 3 Gene [Source:MGI Symbol;Acc:MGI:1918953]
armadillo repeat containing, X-linked 5 Gene [Source:MGI Symbol;Acc:MGI:2148026]
armadillo repeat containing, X-linked 6 Gene [Source:MGI Symbol;Acc:MGI:2147993]
basic helix-loop-helix domain containing, class B9 Gene [Source:MGI Symbol;Acc:MGI:1917487]
G protein-coupled receptor associated sorting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917418]
G protein-coupled receptor associated sorting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25224 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091583 Nonsense 212 377 4 7
Genomic Location:
Chromosome 25 (position 19372472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGTTTTTGCTCTTGCTGTTGTTCAGATTTACATCCCTCCGGTGTTG[C/T]AGCTGATCGAAATGTCACCAGTGAACTCTGACCTTCAGCTTGCAGCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lpbqsm6u