fam69a

Ensembl ID:
ENSDARG00000062955
ZFIN ID:
ZDB-GENE-060421-4286
Description:
Protein FAM69A [Source:UniProtKB/Swiss-Prot;Acc:Q1RLQ5]
Human Orthologue:
FAM69A
Human Description:
family with sequence similarity 69, member A [Source:HGNC Symbol;Acc:32213]
Mouse Orthologue:
Fam69a
Mouse Description:
family with sequence similarity 69, member A Gene [Source:MGI Symbol;Acc:MGI:1914516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2073 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19687 Nonsense Mutation detected in F1 DNA During 2014
sa18374 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Essential Splice Site 18 428 1 5
ENSDART00000137840 None 18 18 1 1
Genomic Location:
Chromosome 2 (position 10433738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGGTCTGTTTTCACGGGCCTGGCTGTCAAAGACGCACCATTTTCAGG[T/A]AACAATCTGGCAAATTAATCTGCATTTCATGACGTTTGGATACCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 260 428 5 5
ENSDART00000137840 None None 18 None 1
Genomic Location:
Chromosome 2 (position 10476533)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATGGATCTGTGGATCCCCGCGGGAATGCGGCGAAGCATGGACCAGTG[G/A]TTCACACCGTCCTGGCCCCGCAAGGCCAAAATCTTCATCGGCTTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 268 428 5 5
ENSDART00000137840 None None 18 None 1
Genomic Location:
Chromosome 2 (position 10476555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAATGCGGCGAAGCATGGACCAGTGGTTCACACCGTCCTGGCCCCGC[A/T]AGGCCAAAATCTTCATCGGCTTGCTGGAACTTATTGAAGACATCTTCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/drg73clb