fam69a

Ensembl ID:
ENSDARG00000062955
ZFIN ID:
ZDB-GENE-060421-4286
Description:
Protein FAM69A [Source:UniProtKB/Swiss-Prot;Acc:Q1RLQ5]
Human Orthologue:
FAM69A
Human Description:
family with sequence similarity 69, member A [Source:HGNC Symbol;Acc:32213]
Mouse Orthologue:
Fam69a
Mouse Description:
family with sequence similarity 69, member A Gene [Source:MGI Symbol;Acc:MGI:1914516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19687 Nonsense Available for shipment Available now
sa18374 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 260 428 5 5
ENSDART00000137840   None 18 None 1
Genomic Location (Zv9):
Chromosome 2 (position 10476533)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10901629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATGGATCTGTGGATCCCCGCGGGAATGCGGCGAAGCATGGACCAGTG[G/A]TTCACACCGTCCTGGCCCCGCAAGGCCAAAATCTTCATCGGCTTGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091570 Nonsense 268 428 5 5
ENSDART00000137840   None 18 None 1
Genomic Location (Zv9):
Chromosome 2 (position 10476555)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 10901651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAATGCGGCGAAGCATGGACCAGTGGTTCACACCGTCCTGGCCCCGC[A/T]AGGCCAAAATCTTCATCGGCTTGCTGGAACTTATTGAAGACATCTTCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link