si:ch211-81a5.7

Ensembl ID:
ENSDARG00000062954
ZFIN ID:
ZDB-GENE-030131-298
Description:
dual specificity protein kinase CLK2 [Source:RefSeq peptide;Acc:NP_001038344]
Human Orthologue:
CLK2
Human Description:
CDC-like kinase 2 [Source:HGNC Symbol;Acc:2069]
Mouse Orthologue:
Clk2
Mouse Description:
CDC-like kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1098669]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36783 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091533 Nonsense 43 527 2 13
ENSDART00000127803 Nonsense 43 526 2 13
ENSDART00000135285 Nonsense 43 186 2 3
ENSDART00000136681   None 153 None 4
ENSDART00000142910   None 325 2 12
Genomic Location (Zv9):
Chromosome 19 (position 9775378)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9233917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACAGAGATCGAGGAAGAAAACCTCGACATCGCCGCTCTCCAACCTA[T/A]TCTTCCAGCAGTGAACGTGAGAGGAGAGCGAGAGGACACAGACAGGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link