nt5dc3

Ensembl ID:
ENSDARG00000062949
ZFIN ID:
ZDB-GENE-080523-3
Human Orthologue:
NT5DC3
Human Description:
5'-nucleotidase domain containing 3 [Source:HGNC Symbol;Acc:30826]
Mouse Orthologue:
Nt5dc3
Mouse Description:
5'-nucleotidase domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:3513266]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38051 Nonsense Mutation detected in F1 DNA During 2017
sa24652 Nonsense Available for shipment Available now
sa44275 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091549 Nonsense 25 576 1 14
Genomic Location (Zv9):
Chromosome 25 (position 19438734)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18850711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAACCTGCTCCGCAATAAGGAGGGTTTTAGGAGACTCGTGGCGCATTA[T/A]AAGTCTCTGCACACCGACAGCGGGTCATGGTTGTTCAGCAGCAGCACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091549 Nonsense 96 576 2 14
Genomic Location (Zv9):
Chromosome 25 (position 19434531)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18846508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTATTAATTAACACACAAATGTGTTGTGTTTTTTTTCACCACAGATT[T/A]AATTCCTGTGATATCAAACAACTTTGTGAACCCAGACACCATCTTCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091549 Nonsense 293 576 7 14
Genomic Location (Zv9):
Chromosome 25 (position 19425050)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 18837027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGTCATAGGAAACGTACATGTCAGAGGGATTATGTATCGAGCAGTC[G/T]AGGCTGATATCGGTAATTTTCAATTTTCCAGGGATAAAAACTACAACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link