im:7155895

Ensembl ID:
ENSDARG00000062947
ZFIN ID:
ZDB-GENE-060810-59
Description:
Im:7155895 protein [Source:UniProtKB/TrEMBL;Acc:Q08C15]
Human Orthologue:
AMN
Human Description:
amnionless homolog (mouse) [Source:HGNC Symbol;Acc:14604]
Mouse Orthologue:
Amn
Mouse Description:
amnionless Gene [Source:MGI Symbol;Acc:MGI:1934943]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6923 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091556 Nonsense 62 478 1 1
Genomic Location (Zv9):
Chromosome 3 (position 57610560)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56808944
KASP Assay ID:
554-5106.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGGAATGACCAAGTGGAGTTTTTAGCAAAYAGGAAAGTGTCGGTGTA[T/A]GTAGAAACAGCTCACACTATTACCGGGATGAGCTTGCCTGTRGATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link