C4orf31

Ensembl ID:
ENSDARG00000062936
Description:
chromosome 4 open reading frame 31 [Source:HGNC Symbol;Acc:26256]
Human Orthologue:
C4orf31
Human Description:
chromosome 4 open reading frame 31 [Source:HGNC Symbol;Acc:26256]
Mouse Orthologue:
A930038C07Rik
Mouse Description:
RIKEN cDNA A930038C07 gene Gene [Source:MGI Symbol;Acc:MGI:1915419]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37595 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091532 Nonsense 284 579 3 3
Genomic Location (Zv9):
Chromosome 23 (position 2076223)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2044318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATTTCCATAAAGATCGTTTCCTCACCACCAACAGAGCTCTGAGCAAC[A/T]AAATGAGTCGCGCATATATCCCCAAGCCCAAAGTGGCCGACATACAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link