LOC565609

Ensembl ID:
ENSDARG00000062934
Human Orthologue:
GPR12
Human Description:
G protein-coupled receptor 12 [Source:HGNC Symbol;Acc:4466]
Mouse Orthologue:
Gpr12
Mouse Description:
G-protein coupled receptor 12 Gene [Source:MGI Symbol;Acc:MGI:101909]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32487 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091528 Nonsense 179 341 1 1
Genomic Location (Zv9):
Chromosome 24 (position 22194748)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21441626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATACACCATGCTGGTGCTTCTATGGGGCGTTTCCTTGTGTTTGGGTT[T/A]GCTCCCAGTCACCGGTGTTAACTGCTTAGGGCAGGAGGTAAACTGCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link