si:ch211-260p9.1

Ensembl ID:
ENSDARG00000062933
ZFIN ID:
ZDB-GENE-050419-50
Description:
Novel protein similar to human c-Maf-inducing protein (CMIP) [Source:UniProtKB/TrEMBL;Acc:Q1LWW3]
Human Orthologue:
AC099480.1
Human Description:
C-Maf-inducing protein [Source:UniProtKB/Swiss-Prot;Acc:Q8IY22]
Mouse Orthologue:
4933407C03Rik
Mouse Description:
RIKEN cDNA 4933407C03 gene Gene [Source:MGI Symbol;Acc:MGI:1921690]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36594 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43067 Nonsense Mutation detected in F1 DNA During 2017
sa32192 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Essential Splice Site 127 679 4 20
Genomic Location (Zv9):
Chromosome 18 (position 12830342)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13385154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCAGAACACTAACCTCAGCGCTCAGGACCACGAAAACATCATTGTGG[T/G]GAGTAGGGCTGCTTTTAGTTTTTTTTTTTTTTGTAACTTAGAAAATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Nonsense 192 679 7 20
Genomic Location (Zv9):
Chromosome 18 (position 12827688)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13382500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTTCGGGAAATGCCCCAGACTCCGTCTCTTTACTCAGGAGTATATTT[T/A]AGCTCTGAATGAGCTTAACGCCGGCATGGAAGTGGTCAAGAAGTTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091512 Nonsense 240 679 8 20
Genomic Location (Zv9):
Chromosome 18 (position 12824327)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 13379139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCCAAATCTCGTAGCGGTTTGCCTGGCTGCCATCTACTCCTGCTAC[G/T]AAGAGTTCATCAACAGGTGCGTCCGATTCTCTGTTTACCCCATGTGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link