prkar1b

Ensembl ID:
ENSDARG00000062926
ZFIN ID:
ZDB-GENE-060929-580
Description:
cAMP-dependent protein kinase type I-beta regulatory subunit [Source:RefSeq peptide;Acc:NP_00107009
Human Orthologue:
PRKAR1B
Human Description:
protein kinase, cAMP-dependent, regulatory, type I, beta [Source:HGNC Symbol;Acc:9390]
Mouse Orthologue:
Prkar1b
Mouse Description:
protein kinase, cAMP dependent regulatory, type I beta Gene [Source:MGI Symbol;Acc:MGI:97759]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25242 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091513 Nonsense 184 380 7 11
ENSDART00000132529 Nonsense 21 217 2 6
Genomic Location (Zv9):
Chromosome 3 (position 12209966)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12905689
KASP Assay ID:
554-7758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCAGATGTGTGTAATGCTCTTTTTCTCTCTGTGTGTCTGCAGGTATA[T/A]GTGAATGGTGAATGGGTGACTAGTATTGGAGAGGGTGGTAGTTTTGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link