si:ch211-243o19.4

Ensembl ID:
ENSDARG00000062924
ZFIN ID:
ZDB-GENE-070424-167
Description:
hypothetical protein LOC100141366 [Source:RefSeq peptide;Acc:NP_001108402]
Human Orthologue:
C14orf45
Human Description:
chromosome 14 open reading frame 45 [Source:HGNC Symbol;Acc:19855]
Mouse Orthologue:
2900006K08Rik
Mouse Description:
RIKEN cDNA 2900006K08 gene Gene [Source:MGI Symbol;Acc:MGI:1920123]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42142 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091502 Nonsense 58 513 2 12
Genomic Location (Zv9):
Chromosome 13 (position 8773863)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9076483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGGAGGCGCGCTGTGACATGACGGAGAGCGCGCGCGTTGAGTACTGT[G/T]AAGCTGCACGACGACTGAACAAAACCAACAAACAACTCAACGACCAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link