mrpl37

Ensembl ID:
ENSDARG00000062916
ZFIN ID:
ZDB-GENE-050309-20
Description:
39S ribosomal protein L37, mitochondrial [Source:RefSeq peptide;Acc:NP_001076324]
Human Orthologue:
MRPL37
Human Description:
mitochondrial ribosomal protein L37 [Source:HGNC Symbol;Acc:14034]
Mouse Orthologue:
Mrpl37
Mouse Description:
mitochondrial ribosomal protein L37 Gene [Source:MGI Symbol;Acc:MGI:1926268]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10750 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091479 Essential Splice Site 400 425 6 7
ENSDART00000146546 Essential Splice Site 405 430 6 7
Genomic Location:
Chromosome 2 (position 10721119)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGAACACGCCCAGGCCCGGGCTCACATCAAGAGGAGAGTCGTCAAG[G/A]TAAAGTCYACTTYATTCATRTTCAGTCCCTGCTGAAAAAAACAGCTKAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhchl22i