polr3b

Ensembl ID:
ENSDARG00000062915
ZFIN ID:
ZDB-GENE-030131-2887
Description:
DNA-directed RNA polymerase [Source:UniProtKB/TrEMBL;Acc:A2BG99]
Human Orthologue:
POLR3B
Human Description:
polymerase (RNA) III (DNA directed) polypeptide B [Source:HGNC Symbol;Acc:30348]
Mouse Orthologue:
Polr3b
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23261 Essential Splice Site Available for shipment Available now
sa43070 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091466 Essential Splice Site 35 1129 2 29
Genomic Location (Zv9):
Chromosome 18 (position 15006025)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15451443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTTCTATTGCAGGAAAAGTGGAAGCTGCTTCCAGCCTTTTTGAAGG[T/A]AGAGTAAATTTAGCAGCTTTGTCATCATTAATTATACATAAATTATGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091466 Essential Splice Site 647 1129 19 29
Genomic Location (Zv9):
Chromosome 18 (position 14984964)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15430382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGAGAACGACTGCAACATTGCTTTATATGAGCACATGATCAGCAAG[T/G]GAGTACTTTGTAGGCTACTACAACTTTCAGGTCCAACAAGTGTTAAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link