ENSDARG00000062913

Ensembl ID:
ENSDARG00000062913
Human Orthologue:
AHNAK
Human Description:
AHNAK nucleoprotein [Source:HGNC Symbol;Acc:347]
Mouse Orthologue:
Ahnak
Mouse Description:
AHNAK nucleoprotein (desmoyokin) Gene [Source:MGI Symbol;Acc:MGI:1316648]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10012 Nonsense Available for shipment Available now
sa17506 Nonsense Available for shipment Available now
sa7345 Missense Mutation detected in F1 DNA During 2014
sa21863 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10012
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091376 Nonsense 21 1477 1 20
Genomic Location:
Chromosome 11 (position 12035745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGACCTGATCTTAAAATCAAATCTCCAAACTTGAATATCAAAAGCCCC[A/T]AAATGAAGGGAGGAATTGACACCCCAGACATGGATCCGACTCTGCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091376 Nonsense 37 1477 1 20
Genomic Location:
Chromosome 11 (position 12035697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCWAAATGAAGGGAGGAATTGACACCCCAGACATGGATCCGACTCTGCCT[C/T]AAGTGAATTTAAAAGCTCCCAACCTAGATCTCAAATCTCCTGATATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091376 Missense 1320 1477 19 20
Genomic Location:
Chromosome 11 (position 12029590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATTTTAAGATACCTGATGTTGGTTTYACAGGACCCAAAATCAATATG[C/A]CTGACTATGATAAGCCAGCTAAAATAAATCTTTCGGCTGCAACGTTTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091376 Nonsense 1450 1477 19 20
Genomic Location:
Chromosome 11 (position 12029200)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTTGACTCTGCCTCAGACTGATCTGAAAACTTCAAATTTAGATTTT[A/T]GACCACCTGATATTGATGTTAATGGCCCTTCAGGTAAATTTAATATGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3q0lybp2