furina

Ensembl ID:
ENSDARG00000062909
ZFIN IDs:
ZDB-GENE-040901-1, ZDB-GENE-040901-1
Description:
furin A [Source:RefSeq peptide;Acc:NP_001038571]
Human Orthologue:
FURIN
Human Description:
furin (paired basic amino acid cleaving enzyme) [Source:HGNC Symbol;Acc:8568]
Mouse Orthologue:
Furin
Mouse Description:
furin (paired basic amino acid cleaving enzyme) Gene [Source:MGI Symbol;Acc:MGI:97513]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40848 Nonsense Mutation detected in F1 DNA During 2016
sa9922 Nonsense Available for shipment Available now
sa31552 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091468 Nonsense 348 713 12 16
ENSDART00000091470 Nonsense 441 806 11 15
Genomic Location (Zv9):
Chromosome 7 (position 15057942)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13935248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATATGGTCTGCTGGACGCTGGGGCCATTGTAGCCTTAGCAAAGAACTG[G/A]ACAAATGTGGGACCTCAGCATAAATGTGTCCTTTCCCTGGTGTCTGAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091468 Nonsense 411 713 13 16
ENSDART00000091470 Nonsense 504 806 12 15
Genomic Location (Zv9):
Chromosome 7 (position 15063550)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 13940856
KASP Assay ID:
2259-8523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGCGCAGCTGACMCTGTCCTACAACCGCAGAGGAAACCTGGCYATCTA[T/A]CWGATCAGCCCACAGGGGACCCGCTCCACACTGCTTCCTCCCAGGTWAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091468 Essential Splice Site 426 713 13 16
ENSDART00000091470 Essential Splice Site 519 806 12 15
Genomic Location (Zv9):
Chromosome 7 (position 15063596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATCTGATCAGCCCACAGGGGACCCGCTCCACACTGCTTCCTCCCAGG[T/C]TAAAATCCTAGAGAGCTACAGTCACACTCATGATATTCAACTCAATTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link