idua

Ensembl ID:
ENSDARG00000062904
ZFIN ID:
ZDB-GENE-060526-29
Description:
Novel protein similar to vertebrate iduronidase, alpha-L-(IDUA) [Source:UniProtKB/TrEMBL;Acc:A2ARH2]
Human Orthologue:
IDUA
Human Description:
iduronidase, alpha-L- [Source:HGNC Symbol;Acc:5391]
Mouse Orthologue:
Idua
Mouse Description:
iduronidase, alpha-L- Gene [Source:MGI Symbol;Acc:MGI:96418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14162 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091463 Nonsense 175 637 5 14
Genomic Location:
Chromosome 5 (position 9447863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTGTKWTTGTAAACAGGGAAATACGGCCTGGGCTTTGTTTCTCAGT[G/A]GAACTTTGAGACKTGGAATGAACCGAACAATCATGATTTTGACAACATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0lc2xmo1