idua

Ensembl ID:
ENSDARG00000062904
ZFIN ID:
ZDB-GENE-060526-29
Description:
Novel protein similar to vertebrate iduronidase, alpha-L-(IDUA) [Source:UniProtKB/TrEMBL;Acc:A2ARH2]
Human Orthologue:
IDUA
Human Description:
iduronidase, alpha-L- [Source:HGNC Symbol;Acc:5391]
Mouse Orthologue:
Idua
Mouse Description:
iduronidase, alpha-L- Gene [Source:MGI Symbol;Acc:MGI:96418]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38450 Nonsense Mutation detected in F1 DNA During 2016
sa14162 Nonsense Available for shipment Available now
sa40364 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091463 Nonsense 72 637 2 14
Genomic Location (Zv9):
Chromosome 5 (position 9442974)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8544846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCAGCCGCACACGGATGCACACCTGTATGATCTCAGTCCAGACCAG[C/T]AGATGAATCTGGCCTTGATCGGCTCAGTGCCACACAGAGGAATCCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091463 Nonsense 175 637 5 14
Genomic Location (Zv9):
Chromosome 5 (position 9447863)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8549735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTGTKWTTGTAAACAGGGAAATACGGCCTGGGCTTTGTTTCTCAGT[G/A]GAACTTTGAGACKTGGAATGAACCGAACAATCATGATTTTGACAACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091463 Nonsense 201 637 6 14
Genomic Location (Zv9):
Chromosome 5 (position 9450191)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8552063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCTTCATTGTCAGGATTATTTTTTCCGGCTCCAGGGTTTCTGAACTA[T/G]TATGATGCGTGTTCTGAGGGCCTTCGTGCAGCGAGTCCTTTGTTGAAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link