si:ch211-155m12.3

Ensembl ID:
ENSDARG00000062897
ZFIN ID:
ZDB-GENE-030131-4865
Description:
tankyrase 1 [Source:RefSeq peptide;Acc:NP_001082884]
Human Orthologue:
TNKS
Human Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase [Source:HGNC Symbol;Acc:11941]
Mouse Orthologue:
Tnks
Mouse Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6961 Nonsense Mutation detected in F1 DNA During 2017
sa13277 Nonsense Available for shipment Available now
sa40363 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091397 Nonsense 352 1267 7 27
Genomic Location (Zv9):
Chromosome 5 (position 9383537)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8485409
KASP Assay ID:
554-5091.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTTGTTCACNNNNNNTCTCTCCATCAGTGGTTTGGTTCCTCTGCATAATGCCTG[T/A]TCTTATGGTCACTATGAGGTCACWGAACTCCTGCTGAAGGTAATGGWGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091397 Nonsense 389 1267 8 27
Genomic Location (Zv9):
Chromosome 5 (position 9385109)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8486981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGACCTCTGGCAGTTCACRCCRCTGCACGAGGCGGCCAGTAAGAAT[C/T]GAGTGGAGGYTTGTTCWCTGCTGCTGAGTCACGGCGCAGATCCAACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091397 Essential Splice Site 712 1267 15 27
Genomic Location (Zv9):
Chromosome 5 (position 9398013)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8499885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGCTGCAGCAAAGGGCAAATACGAGATCTGCAAACTACTGCTCAAG[G/A]TTTGACGCATCGATGTTTTCAACACATTTCTAAACAGAATAGTTTTAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link