si:dkey-103i16.6

Ensembl ID:
ENSDARG00000062893
ZFIN ID:
ZDB-GENE-061207-46
Description:
hypothetical protein LOC557125 [Source:RefSeq peptide;Acc:NP_001038173]
Human Orthologue:
SIRT3
Human Description:
sirtuin 3 [Source:HGNC Symbol;Acc:14931]
Mouse Orthologue:
Sirt3
Mouse Description:
sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23259 Nonsense Available for shipment Available now
sa36601 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23260 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Nonsense 93 370 2 6
Genomic Location (Zv9):
Chromosome 18 (position 14871210)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15316628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGCGGGGCTTTGGAAACCATCGGCAGGCTGATGAAGCTTGGTCGAGTG[C/T]GAAACATTGTGGTAGTTGCTGGAGCAGGAATCAGCACAGCCAGCGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Essential Splice Site 113 370 2 6
Genomic Location (Zv9):
Chromosome 18 (position 14871273)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15316691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTGCTGGAGCAGGAATCAGCACAGCCAGCGGGATCCCAGACTTCAGG[T/C]GAACACACACACAAAACCACAAACCTTCAGACTGCTGCTAAAATCTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099777 Essential Splice Site 190 370 3 6
Genomic Location (Zv9):
Chromosome 18 (position 14871589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15317007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTGCTGCTCCGCATGTACACCCAGAACATCGACGGTCTCGAAAAAC[G/T]TGAGCTTAAATGGACAGTTCAGATAAAAATAAAATAATTGTCGTTTACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link