si:dkey-165l22.3

Ensembl ID:
ENSDARG00000062891
ZFIN ID:
ZDB-GENE-081104-327
Human Orthologue:
SSFA2
Human Description:
sperm specific antigen 2 [Source:HGNC Symbol;Acc:11319]
Mouse Orthologue:
Ssfa2
Mouse Description:
sperm specific antigen 2 Gene [Source:MGI Symbol;Acc:MGI:1917849]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21587 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091327 Essential Splice Site 173 320 9 12
ENSDART00000147990   None 102 None 5
Genomic Location (Zv9):
Chromosome 9 (position 45452682)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 44584761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGACAAAGCAGCGGAACAGGAAGAACTTGGGTGAGGGTAGGGATGTG[T/C]GAAGTCTGTAATAATGCCTGTTTTTGTTGATGGCGAGTGCACTGCATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link