LOC558321

Ensembl ID:
ENSDARG00000062884
Human Orthologue:
MAP3K2
Human Description:
mitogen-activated protein kinase kinase kinase 2 [Source:HGNC Symbol;Acc:6854]
Mouse Orthologue:
Map3k2
Mouse Description:
mitogen-activated protein kinase kinase kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1346873]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7025 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091370 Nonsense 19 623 2 16
Genomic Location:
Chromosome 6 (position 8163215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGCAGGAGGCCCTGAATTCCATCATGCAAGACCTGGCGGTGTTGCAT[C/T]GATCCAGTCGACCATCTGTTCTGTCTGACCTGGCCAAACCCAAGGCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mf77l4w9