si:ch211-247h9.1

Ensembl ID:
ENSDARG00000062880
ZFIN ID:
ZDB-GENE-081030-10
Description:
Novel protein similar to vertebrate contactin 4 (CNTN4) [Source:UniProtKB/TrEMBL;Acc:B8JI47]
Human Orthologues:
CNTN3, CNTN4, CNTN6
Human Descriptions:
contactin 3 (plasmacytoma associated) [Source:HGNC Symbol;Acc:2173]
contactin 4 [Source:HGNC Symbol;Acc:2174]
contactin 6 [Source:HGNC Symbol;Acc:2176]
Mouse Orthologues:
Cntn3, Cntn4, Cntn6
Mouse Descriptions:
contactin 3 Gene [Source:MGI Symbol;Acc:MGI:99534]
contactin 4 Gene [Source:MGI Symbol;Acc:MGI:1095737]
contactin 6 Gene [Source:MGI Symbol;Acc:MGI:1858223]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37632 Nonsense Mutation detected in F1 DNA During 2017
sa14505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 169 1028 5 22
ENSDART00000131355 Nonsense 169 998 6 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11869326)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11828128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGAGTTGACCTTTTCCTGGATCTTCAACGAATATCCCTCATTCGTC[G/T]AGCAGGACACGCGGCGCTTTGTGTCACAGAAAACAGGCAACCTGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091416 Nonsense 538 1028 12 22
ENSDART00000131355 Nonsense 538 998 13 22

The following transcripts of ENSDARG00000062880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11948637)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11907439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCATGTCAGGTGTCACGTGACCCTTCACTGGATGTCAGAKTCACCTG[G/A]TTTTTCAATGAACAGCTGATYAACTTTGGAAGCCATGGGGGATATTTYGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link