eea1

Ensembl ID:
ENSDARG00000062868
ZFIN IDs:
ZDB-GENE-041008-68, ZDB-GENE-041111-270
Description:
Novel protein similar to H.sapiens EEA1, early endosome antigen 1 (EEA1) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
EEA1
Human Description:
early endosome antigen 1 [Source:HGNC Symbol;Acc:3185]
Mouse Orthologue:
Eea1
Mouse Description:
early endosome antigen 1 Gene [Source:MGI Symbol;Acc:MGI:2442192]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29005 Nonsense Mutation detected in F1 DNA During 2017
sa36607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091349 Nonsense 242 1398 9 30
ENSDART00000141800 Nonsense 242 811 9 19
ENSDART00000142527   None 255 None 5
Genomic Location (Zv9):
Chromosome 18 (position 15531445)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15883857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGACCCGAGAGCGAGAGGAGGAGTCAGAGCGCCTCAAAGGCCAATA[T/G]GAGCAGCTGCAGGCCAACTTCACTACCTCAGAGGTACAGATGGCTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091349 Nonsense 395 1398 11 30
ENSDART00000141800 Nonsense 395 811 11 19
ENSDART00000142527   None 255 None 5
Genomic Location (Zv9):
Chromosome 18 (position 15542653)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15895065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCAGAGCGGAAACAACTTCAACAGCAGAGGGAGGATAAAGAAAAC[C/T]AGGGCCTGCAGCAACAGAGTGAGATCAGCCAGGTCAGTAAGAGATGCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link