eea1

Ensembl ID:
ENSDARG00000062868
ZFIN IDs:
ZDB-GENE-041008-68, ZDB-GENE-041111-270
Description:
Novel protein similar to H.sapiens EEA1, early endosome antigen 1 (EEA1) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
EEA1
Human Description:
early endosome antigen 1 [Source:HGNC Symbol;Acc:3185]
Mouse Orthologue:
Eea1
Mouse Description:
early endosome antigen 1 Gene [Source:MGI Symbol;Acc:MGI:2442192]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29005 Nonsense Mutation detected in F1 DNA During 2017
sa36607 Nonsense Available for shipment Available now
sa44886 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091349 Nonsense 242 1398 9 30
ENSDART00000141800 Nonsense 242 811 9 19
ENSDART00000142527   None 255 None 5
Genomic Location (Zv9):
Chromosome 18 (position 15531445)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15883857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGACCCGAGAGCGAGAGGAGGAGTCAGAGCGCCTCAAAGGCCAATA[T/G]GAGCAGCTGCAGGCCAACTTCACTACCTCAGAGGTACAGATGGCTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091349 Nonsense 395 1398 11 30
ENSDART00000141800 Nonsense 395 811 11 19
ENSDART00000142527   None 255 None 5
Genomic Location (Zv9):
Chromosome 18 (position 15542653)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15895065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCAGAGCGGAAACAACTTCAACAGCAGAGGGAGGATAAAGAAAAC[C/T]AGGGCCTGCAGCAACAGAGTGAGATCAGCCAGGTCAGTAAGAGATGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091349 Essential Splice Site 1143 1398 24 30
ENSDART00000141800   None 811 None 19
ENSDART00000142527   None 255 None 5
Genomic Location (Zv9):
Chromosome 18 (position 15554276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAAACTGTCTGCTGATCTCAAAACACTGGCTGAGAAGAATGAGAAG[G/A]TTAGACCCCAAAACACATTGAAATTCACATTAACAATCATGTAATGTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link