gk5

Ensembl ID:
ENSDARG00000062864
ZFIN ID:
ZDB-GENE-061110-49
Description:
Putative glycerol kinase 5 [Source:UniProtKB/Swiss-Prot;Acc:A0JPE9]
Human Orthologue:
GK5
Human Description:
glycerol kinase 5 (putative) [Source:HGNC Symbol;Acc:28635]
Mouse Orthologue:
Gk5
Mouse Description:
glycerol kinase 5 (putative) Gene [Source:MGI Symbol;Acc:MGI:2443336]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32875 Nonsense Mutation detected in F1 DNA During 2017
sa19717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091351 Nonsense 455 529 15 16
Genomic Location (Zv9):
Chromosome 2 (position 16510124)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17020951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACTTCATCATGCAACTGACGGCTGATCTGTTGGGACGCAAAATCGCA[C/T]GACCAAGCCATTTCGACATGTCCTGCCTTGGAGCTGCTTTTGTTGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091351 Nonsense 477 529 16 16
Genomic Location (Zv9):
Chromosome 2 (position 16514308)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 17024836
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTATCCTAATCTGCATGCTTTATTCTGAATTGTCTTTTAGGCTACTG[G/A]AGGAACCAAGAAGAGCTGAAGAAGCTTTTGTCAACTGACCAACATTTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link