plekhg7

Ensembl ID:
ENSDARG00000062855
ZFIN ID:
ZDB-GENE-070410-15
Description:
pleckstrin homology domain-containing family G member 7 [Source:RefSeq peptide;Acc:NP_001038464]
Human Orthologue:
PLEKHG7
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 7 [Source:HGNC Symbol;Ac

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6507 Nonsense Mutation detected in F1 DNA During 2017
sa23266 Essential Splice Site Available for shipment Available now
sa23265 Essential Splice Site Available for shipment Available now
sa23264 Essential Splice Site Available for shipment Available now
sa23263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091339 Nonsense 73 769 1 16
ENSDART00000127769 Nonsense 73 769 2 17

The following transcripts of ENSDARG00000062855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15606026)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15958438
KASP Assay ID:
554-5088.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTGCACAATGCGAATAAATTTYGACAGCACGTCATCAGGCATGAAAT[T/G]AGGTTCTGTGACAACGTCAAATTGCACGTCTGGGGACTTGATCACTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091339 Essential Splice Site 262 769 2 16
ENSDART00000127769 Essential Splice Site 262 769 3 17

The following transcripts of ENSDARG00000062855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15602432)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15954844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTGTATCTGCTTTTGATTACAGGTCAAGGATCCATGTCATAAAAG[G/A]TAGGTGAGCTGTTTCTAATCTAAAGTTTTGCATAAGCCATTCACTATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091339 Essential Splice Site 347 769 5 16
ENSDART00000127769 Essential Splice Site 347 769 6 17

The following transcripts of ENSDARG00000062855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15590371)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15942783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGTTCAGGTCCCCGAATGGAGAGACACAGACTTTCAGACCTTTAAG[G/A]TGAGAGTCCAAAACCGATGGAGGGAAATCATTTTGAAAACCACTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091339 Essential Splice Site 428 769 7 16
ENSDART00000127769 Essential Splice Site 428 769 8 17

The following transcripts of ENSDARG00000062855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15584375)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15936787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATCGACTCCTGGAGGCTCTTTGCAAATCTCAATGAGCTTTGTTTGG[T/A]AAGAAATTAAGGAGGATAATGTAACTGTAAATGTATTCAAACTGTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23263
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091339 Nonsense 571 769 11 16
ENSDART00000127769 Nonsense 571 769 12 17

The following transcripts of ENSDARG00000062855 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 15572867)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15925279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTTTGTAGATGATCTTGAAGGGAAAGTCAAGTGGTTGGACAACTA[T/A]CAGAAGGTGAAGCAGCTGAAGGAAACTCTAGTGTGGCTTCCTGTTTGGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link