tmtc3

Ensembl ID:
ENSDARG00000062846
ZFIN ID:
ZDB-GENE-061221-2
Human Orthologue:
TMTC3
Human Description:
transmembrane and tetratricopeptide repeat containing 3 [Source:HGNC Symbol;Acc:26899]
Mouse Orthologue:
Tmtc3
Mouse Description:
transmembrane and tetratricopeptide repeat containing 3 Gene [Source:MGI Symbol;Acc:MGI:3036255]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16523 Nonsense Available for shipment Available now
sa17975 Nonsense Available for shipment Available now
sa24646 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091292 Nonsense 71 932 2 13
Genomic Location:
Chromosome 25 (position 18497899)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTCCGACCTCATCTTTTTCTGCAGGAGCGGAGCCAKAAGTCCTAC[C/T]GACCGCTTACTGTTCTGACCTTCCGCCTCAATTACCTGTTCAGCGAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091292 Nonsense 90 932 2 13
Genomic Location:
Chromosome 25 (position 18497957)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTTCTGACCTTCCGCCTCAATTACCTGTTCAGCGAGTTGAACTCCT[C/A]GTCGTACCACCTCCTCAATGTGGTTCTCCAYGCTGTGGTGTGTGTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091292 Nonsense 588 932 12 13
Genomic Location:
Chromosome 25 (position 18535946)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCTGCTGAAAATGAACAAGCCCAGTGAGGCAAAGGATGCCTACCTA[C/T]GAGCACTGGAGCTGGACCATACCAATGCAGACCTCTGGTACAATCTGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tka52m78