LOC100333183

Ensembl ID:
ENSDARG00000062840
Human Orthologue:
DTX1
Human Description:
deltex homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:3060]
Mouse Orthologue:
Dtx1
Mouse Description:
deltex 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1352744]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24768 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091274 Nonsense 89 327 4 10
Genomic Location:
Chromosome Zv9_NA771 (position 22121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGGAATCAACAGCATCCGACGCAAAACCAAGAAAAAACACCTGCGC[A/T]AAGGTGAGGACACACTCTAACACTCTCTCTAGCCACATTACATTTTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lxkdzrrd