LOC556339

Ensembl ID:
ENSDARG00000062839
Human Orthologue:
PRKG2
Human Description:
protein kinase, cGMP-dependent, type II [Source:HGNC Symbol;Acc:9416]
Mouse Orthologue:
Prkg2
Mouse Description:
protein kinase, cGMP-dependent, type II Gene [Source:MGI Symbol;Acc:MGI:108173]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22218 Nonsense Available for shipment Available now
sa4488 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Nonsense 713 763 17 18
Genomic Location:
Chromosome 13 (position 7515770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAATTATTGAGGCTTAGTTTGTTCTGTTATTTTCCCACAGATGGTTT[C/T]AAGGTTTCAACTGGGAAGGATTGAGACGCCGGAAGCTGATGTCTCCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Nonsense 720 763 17 18
Genomic Location:
Chromosome 13 (position 7515792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCTGTTRTTTTCCCACAGATGGTTTCAAGGTTTCAACTGGGAAGGAT[T/A]GAGACGCCGGAAGCTGATGTCTCCTCTAAGGAGAGAGGTGAAGAAYGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jn6xye9a