LOC556339

Ensembl ID:
ENSDARG00000062839
Human Orthologue:
PRKG2
Human Description:
protein kinase, cGMP-dependent, type II [Source:HGNC Symbol;Acc:9416]
Mouse Orthologue:
Prkg2
Mouse Description:
protein kinase, cGMP-dependent, type II Gene [Source:MGI Symbol;Acc:MGI:108173]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35418 Nonsense Mutation detected in F1 DNA During 2016
sa31905 Essential Splice Site Available for shipment Available now
sa35419 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22218 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Nonsense 239 763 3 18
Genomic Location (Zv9):
Chromosome 13 (position 7480330)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7784940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGGTCAGATGCGTCCTGGAACAGCCTTCGGAGAGCTGGCCATTCTCTA[T/A]AACTGTAAAAGAACTGCTACGGTCAAAGGTAGATTTTATTATGCTTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Essential Splice Site 593 763 13 18
Genomic Location (Zv9):
Chromosome 13 (position 7501987)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7806597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAAGCCAGAGAATCTTCTTCTGGATGCCGAAGGCTATGTCAAAATGG[T/C]TATTTCACTTGAACTACTAAAAGCTTAAGTGCATAAGTAAATATTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Essential Splice Site 689 763 16 18
Genomic Location (Zv9):
Chromosome 13 (position 7508121)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7812731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTAAATGAGAACAGTCAGAAACTCTTTTGTCTCATTTATTCTCTCC[A/G]GACTCAATCCAGCAGAACGGCTTGGGAATAAAAAGAATGGCATCATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091271 Nonsense 713 763 17 18
Genomic Location (Zv9):
Chromosome 13 (position 7515770)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7820380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAATTATTGAGGCTTAGTTTGTTCTGTTATTTTCCCACAGATGGTTT[C/T]AAGGTTTCAACTGGGAAGGATTGAGACGCCGGAAGCTGATGTCTCCTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link