LOC560816

Ensembl ID:
ENSDARG00000062831
Human Orthologues:
PVR, PVRL2
Human Descriptions:
poliovirus receptor [Source:HGNC Symbol;Acc:9705]
poliovirus receptor-related 2 (herpesvirus entry mediator B) [Source:HGNC Symbol;Acc:9707]
Mouse Orthologues:
Pvr, Pvrl2
Mouse Descriptions:
poliovirus receptor Gene [Source:MGI Symbol;Acc:MGI:107741]
poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4641 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091241 Nonsense 466 505 7 8
Genomic Location:
Chromosome 16 (position 12242998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTGGAAAGGAAGAAATTCGATGAGCTCGAAGAAGARGACGAGCGATA[T/G]GACCATTTCAGTGGGGGCGGACCCATCCTTCAGCTCCGCCCACATGACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bab2wgci