LOC563833

Ensembl ID:
ENSDARG00000062828
Mouse Orthologues:
9930111J21Rik1, 9930111J21Rik2, Ifi47, Irgc1
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
RIKEN cDNA 9930111J21 gene 1 Gene [Source:MGI Symbol;Acc:MGI:3041173]
RIKEN cDNA 9930111J21 gene 2 Gene [Source:MGI Symbol;Acc:MGI:3711310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23469 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091249 Essential Splice Site 193 401 2 3
Genomic Location:
Chromosome 19 (position 11751380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACTTGGAAGAGACACTGGATGCCATCCGAGAGGACTGTGTAAATGG[T/G]TAGTTCAGTTCACATGACAATACTTTGAGTAGCAACTTAATAAGAAACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4vcu5fij