pi4kab

Ensembl ID:
ENSDARG00000062823
ZFIN ID:
ZDB-GENE-080220-34
Description:
phosphatidylinositol 4-kinase, catalytic, alpha b [Source:RefSeq peptide;Acc:NP_001106813]
Human Orthologue:
PI4KA
Human Description:
phosphatidylinositol 4-kinase, catalytic, alpha [Source:HGNC Symbol;Acc:8983]
Mouse Orthologue:
Pi4ka
Mouse Description:
phosphatidylinositol 4-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:2448506]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27124 Nonsense Mutation detected in F1 DNA During 2017
sa11490 Essential Splice Site Available for shipment Available now
sa12448 Nonsense Available for shipment Available now
sa41098 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091235 Nonsense 319 1099 10 30
ENSDART00000114476 Nonsense 353 1986 10 52
ENSDART00000140077 Nonsense 353 907 10 23
Genomic Location (Zv9):
Chromosome 8 (position 1988286)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1800668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAATGCAGGCGTGGATCTGTTCTACAAAGGCTTCAGCGACCCGCTGTA[C/A]GTCAGCATGTTCAAGATGCTCAGAGACACGCTTTATTACATGAAAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091235 Essential Splice Site 939 1099 25 30
ENSDART00000114476 Essential Splice Site 973 1986 25 52
ENSDART00000140077   None 907 None 23
Genomic Location (Zv9):
Chromosome 8 (position 1934262)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1746426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGATCCGCAGGGTGGCAGATAAATACCTGTCAGGACTCGCAGAAACG[T/G]AATGCTCTTCTCTGCTTGGTGCACACTAGAGAGATCCCTAAGTAGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12448
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091235 Nonsense 945 1099 26 30
ENSDART00000114476 Nonsense 979 1986 26 52
ENSDART00000140077   None 907 None 23
Genomic Location (Zv9):
Chromosome 8 (position 1932919)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1745083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATAAATAAAAGCTGTGTGTTTGTGCTGTAGGTTTCCTCATCTGTTGT[G/A]GAGCGGAAGAGTTTTGAAGACGATGCTGGATATCCTGCAGACTCTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41098
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091235   None 1099 None 30
ENSDART00000114476 Nonsense 1168 1986 31 52
ENSDART00000140077   None 907 None 23
Genomic Location (Zv9):
Chromosome 8 (position 1915517)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1727681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCAGATGAGTGACGCTCTGGAGGCCAAAGACCCGGACGCTTTCACA[C/T]AGAACATGTTCAAGATGACGGCGCTGCTCATCAGCACTAAAGGTACAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link