si:ch211-154h20.4

Ensembl ID:
ENSDARG00000062821
ZFIN ID:
ZDB-GENE-050420-93
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:Q1LVQ4]
Human Orthologue:
SLC6A15
Human Description:
solute carrier family 6 (neutral amino acid transporter), member 15 [Source:HGNC Symbol;Acc:13621]
Mouse Orthologue:
Slc6a15
Mouse Description:
solute carrier family 6 (neurotransmitter transporter), member 15 Gene [Source:MGI Symbol;Acc:MGI:21

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6508 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091225   None 197 None 4
ENSDART00000125353 Essential Splice Site 377 741 6 11
Genomic Location (Zv9):
Chromosome 18 (position 15817371)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16169137
KASP Assay ID:
554-4038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCTGGGCTTYAAAGCCAACATCATGAATGCCAAATGTGTGGAAATG[T/C]AAGTGAAAACACTYCAWAAACGTTATAAAACTCAATATAGAGCCAGCGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link