p2ry10

Ensembl ID:
ENSDARG00000062811
ZFIN ID:
ZDB-GENE-070410-105
Description:
G-protein coupled purinergic receptor P2Y10 [Source:RefSeq peptide;Acc:NP_001082996]
Human Orthologue:
P2RY10
Human Description:
purinergic receptor P2Y, G-protein coupled, 10 [Source:HGNC Symbol;Acc:19906]
Mouse Orthologues:
A630033H20Rik, P2ry10
Mouse Descriptions:
purinergic receptor P2Y, G-protein coupled 10 Gene [Source:MGI Symbol;Acc:MGI:1926076]
RIKEN cDNA A630033H20 gene Gene [Source:MGI Symbol;Acc:MGI:2441814]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35641 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091224 Nonsense 184 334 3 3
Genomic Location (Zv9):
Chromosome 14 (position 10713829)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10209186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATTCGTCACTGGGTAACAGAAGCTGCTTCAAAGACCTGCCAATGCGC[A/T]AGCTGAATTTTCAGTTAGCCATTTCTATGATGGCCGCCGCTGAACTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link