baiap2a

Ensembl ID:
ENSDARG00000062799
ZFIN ID:
ZDB-GENE-060421-2756
Description:
BAI1-associated protein 2a [Source:RefSeq peptide;Acc:NP_001035335]
Human Orthologue:
BAIAP2
Human Description:
BAI1-associated protein 2 [Source:HGNC Symbol;Acc:947]
Mouse Orthologue:
Baiap2
Mouse Description:
brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2137336

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11319 Nonsense Available for shipment Available now
sa9258 Nonsense Mutation detected in F1 DNA During 2014
sa3458 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18768 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5229 Nonsense Mutation detected in F1 DNA During 2014
sa8395 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 177 490 6 12
ENSDART00000123659 Nonsense 201 514 7 13
Genomic Location:
Chromosome 3 (position 52481705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCAGAGGGCTACAAAACAGCGCTTTCAGAGGAACGTAGGAGATACTG[T/A]TTCCTGGTGGACCGCCAATGCGCTGTAGCCAAGAACAGCAGYGCCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 343 490 8 12
ENSDART00000123659 Nonsense 367 514 9 13
Genomic Location:
Chromosome 3 (position 52493916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGACGTMTATTCCAACACCCTGCCTGTCCGCAGGCCTCAGYCCGCT[A/T]AAAACAAGACCACTGTGGGTAAGAAAACAAACTGTTTTGCTTAGCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
Genomic Location:
Chromosome 3 (position 52496033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACACCCGAGTGCTGCCTGACAGTGATGGCGAAAAGTTAAGAGTCAAG[T/C]AAGTGTATGTTTCTGTCCTTATCTATAAAGTTTTTGGCTTCATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
ENSDART00000091180 Essential Splice Site 439 490 10 12
ENSDART00000123659 Essential Splice Site 463 514 11 13
Genomic Location:
Chromosome 3 (position 52496033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACACCCGAGTGCTGCCTGACAGTGATGGCGAAAAGTTAAGAGTCAAG[T/C]AAGTGTATGTTTCTGTCCTTATCTATAAAGTTTTTGGCTTCATGTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
Genomic Location:
Chromosome 3 (position 52499269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATGGKTTGACTGCCCGACTGTTGGCACAGAGCCTTACACAGAGCCGA[C/T]AGCGTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACACAAACTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
Genomic Location:
Chromosome 3 (position 52499269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATGGKTTGACTGCCCGACTGTTGGCACAGAGCCTTACACAGAGCCGA[C/T]AGCRTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACACAAACTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9qwrdmo7