baiap2a

Ensembl ID:
ENSDARG00000062799
ZFIN ID:
ZDB-GENE-060421-2756
Description:
BAI1-associated protein 2a [Source:RefSeq peptide;Acc:NP_001035335]
Human Orthologue:
BAIAP2
Human Description:
BAI1-associated protein 2 [Source:HGNC Symbol;Acc:947]
Mouse Orthologue:
Baiap2
Mouse Description:
brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2137336

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33307 Nonsense Mutation detected in F1 DNA During 2016
sa11319 Nonsense Available for shipment Available now
sa40162 Nonsense Mutation detected in F1 DNA During 2016
sa9258 Nonsense Mutation detected in F1 DNA During 2016
sa33308 Nonsense Mutation detected in F1 DNA During 2016
sa8395 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 9 490 1 12
ENSDART00000123659 Nonsense 33 514 2 13
Genomic Location (Zv9):
Chromosome 3 (position 52362153)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51487561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTTGCTTGCAGAACATCATGGAACAGTTCAATCCCTG[T/A]TTGCGGAATTTCATCGCAATGGGCAAGAACTACGAGAAGGCTCTCTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 177 490 6 12
ENSDART00000123659 Nonsense 201 514 7 13
Genomic Location (Zv9):
Chromosome 3 (position 52481705)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51607113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCAGAGGGCTACAAAACAGCGCTTTCAGAGGAACGTAGGAGATACTG[T/A]TTCCTGGTGGACCGCCAATGCGCTGTAGCCAAGAACAGCAGYGCCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 258 490 7 12
ENSDART00000123659 Nonsense 282 514 8 13
Genomic Location (Zv9):
Chromosome 3 (position 52491667)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51617075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTCATCCAAGGGGAACCTGGTCATCTCAGATCCCATTCCTGGAGCA[C/T]AACCGCTGCCCGTGCCCCCCGAACTAGCTGCCTTCATGGGAGGTGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 343 490 8 12
ENSDART00000123659 Nonsense 367 514 9 13
Genomic Location (Zv9):
Chromosome 3 (position 52493916)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51619324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCGACGTMTATTCCAACACCCTGCCTGTCCGCAGGCCTCAGYCCGCT[A/T]AAAACAAGACCACTGTGGGTAAGAAAACAAACTGTTTTGCTTAGCCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 477 490 11 12
ENSDART00000123659 Nonsense 501 514 12 13
Genomic Location (Zv9):
Chromosome 3 (position 52499260)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51624668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGCCTGACTATGGGTTGACTGCCCGACTGTTGGCACAGAGCCTTACA[C/T]AGAGCCGACAGCGTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
ENSDART00000091180 Nonsense 480 490 11 12
ENSDART00000123659 Nonsense 504 514 12 13
Genomic Location (Zv9):
Chromosome 3 (position 52499269)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 51624677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATGGKTTGACTGCCCGACTGTTGGCACAGAGCCTTACACAGAGCCGA[C/T]AGCRTCCCTACAGCATGGCAGGCTTTGCACAGGTACACACACAAACTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link