nell2b

Ensembl ID:
ENSDARG00000062797
ZFIN ID:
ZDB-GENE-030131-8026
Description:
Novel protein similar to vertebrate NEL-like 2, chicken (NELL2) [Source:UniProtKB/TrEMBL;Acc:Q1L8H4]
Human Orthologue:
NELL2
Human Description:
NEL-like 2 (chicken) [Source:HGNC Symbol;Acc:7751]
Mouse Orthologue:
Nell2
Mouse Description:
NEL-like 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:1858510]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31389 Essential Splice Site Available for shipment Available now
sa18051 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091151 Essential Splice Site 356 841 10 21
ENSDART00000133325 Essential Splice Site 270 755 7 18
Genomic Location (Zv9):
Chromosome 4 (position 13373008)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14309380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATACCGCTCCAATCTACATGCCTGGAGCTTGCTGTAAAGAATGCCAGC[G/A]TGAGTACGCACATACACACACACACACACACTCACACACAAAAATAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091151 Nonsense 672 841 18 21
ENSDART00000133325 Nonsense 586 755 15 18
Genomic Location (Zv9):
Chromosome 4 (position 13321215)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14257587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCTGCCCGCATGGTAGGAACTGCACTGGAGACTGCGCTCATGACGGC[A/T]AGGTGAAACACAACGGGCAGATYTGGGTGCTGGATGATGACAGGTGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link