si:ch73-218h2.1

Ensembl ID:
ENSDARG00000062796
ZFIN ID:
ZDB-GENE-100921-75
Human Orthologue:
FKBP10
Human Description:
FK506 binding protein 10, 65 kDa [Source:HGNC Symbol;Acc:18169]
Mouse Orthologue:
Fkbp10
Mouse Description:
FK506 binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:104769]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29181 Nonsense Mutation detected in F1 DNA During 2017
sa23493 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Nonsense 35 569 1 10
ENSDART00000142475 Nonsense 27 555 1 10
Genomic Location (Zv9):
Chromosome 19 (position 18185952)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19031187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTTAGAAGATGTAATTATTGATCGCTACTTTATACCAGCGTTCTG[T/A]CCAAGAGAGGTTCAGATCGGAGACTATGTTCGGTATGACTATAACGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104447 Nonsense 391 569 7 10
ENSDART00000142475 Nonsense 378 555 7 10
Genomic Location (Zv9):
Chromosome 19 (position 18224369)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19069604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTTGCAACCTGACAAGTGATGCAAATGATCTGATTTTGTATCGCTA[T/A]AACTGCTCTTTGTTGGATGGCACACGTCTCTACTCTTCGTAAGTACTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link