abcb7

Ensembl ID:
ENSDARG00000062795
ZFIN ID:
ZDB-GENE-050517-10
Human Orthologue:
ABCB7
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 7 [Source:HGNC Symbol;Acc:48]
Mouse Orthologue:
Abcb7
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 7 Gene [Source:MGI Symbol;Acc:MGI:109533]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091169 Nonsense 210 743 6 16
Genomic Location:
Chromosome 14 (position 11221368)
KASP Assay ID:
554-0266.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGGCTCTCTTTAATGAACTCAGAAATGCCGTGTTTGGAAAAGTGGCA[C/T]AGAGCTCCATCAGGAGGATAGCCAAGAATGTGTTTCTCCATCTTCATAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sxaqnf16