TACC2

Ensembl ID:
ENSDARG00000062790
Description:
transforming, acidic coiled-coil containing protein 2 [Source:HGNC Symbol;Acc:11523]
Human Orthologue:
TACC2
Human Description:
transforming, acidic coiled-coil containing protein 2 [Source:HGNC Symbol;Acc:11523]
Mouse Orthologue:
Tacc2
Mouse Description:
transforming, acidic coiled-coil containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:1928899]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35509 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Essential Splice Site 1200 1297 16 19
Genomic Location (Zv9):
Chromosome 13 (position 29116372)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28762320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCCGTCGCTACGAGAAGATGAAAGATGTTTTGGAAGGTTTCCGCAAA[G/A]TGAGTCACTTGAGAATTTTCATTTGGAGTTTATTTGAATTTTTGTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101653 Nonsense 1212 1297 17 19
Genomic Location (Zv9):
Chromosome 13 (position 29123737)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28769685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTTTTTCCATCAGAATGAGGATGTCCTAAAGAAATGTGCGCAGGAATA[T/A]CTGTCTCGTGTTCGTAAGGAGGAGCAGCGCTATCAGGCCCTAAAGATTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link