LOC797748

Ensembl ID:
ENSDARG00000062781
Human Orthologues:
GLS, GLS2
Human Descriptions:
glutaminase 2 (liver, mitochondrial) [Source:HGNC Symbol;Acc:29570]
glutaminase [Source:HGNC Symbol;Acc:4331]
Mouse Orthologues:
Gls, Gls2
Mouse Descriptions:
glutaminase 2 (liver, mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:2143539]
glutaminase Gene [Source:MGI Symbol;Acc:MGI:95752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44281 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091132 Nonsense 297 643 10 21
Genomic Location (Zv9):
Chromosome 25 (position 19999605)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19411582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTATATACGGCCTGGCAGTGGATCAGCAGGGCTCAGACTACGTGCAC[A/T]GATATGTGGGAATGGAGGAATATTCCAAATACGAGTCTCTGTTCACCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link