cpne4

Ensembl ID:
ENSDARG00000062754
ZFIN ID:
ZDB-GENE-060503-926
Description:
Novel protein similar to vertebrate copine IV (CPNE4) [Source:UniProtKB/TrEMBL;Acc:Q1LUM8]
Human Orthologue:
CPNE4
Human Description:
copine IV [Source:HGNC Symbol;Acc:2317]
Mouse Orthologue:
Cpne4
Mouse Description:
copine IV Gene [Source:MGI Symbol;Acc:MGI:1921270]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16481 Essential Splice Site Available for shipment Available now
sa23496 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091090 Essential Splice Site 510 553 14 15
ENSDART00000146929 Essential Splice Site 511 554 14 15
Genomic Location:
Chromosome 19 (position 18741597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCTGAGGGACATTGTGCAGTTTGTGCCCTTCCGCAACTTCAAACATG[T/C]AAGTAAAATATGGTCGGAACCTAATATGGTCATACNNNNNNNNNNNRTTTTATTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091090 Nonsense 545 553 15 15
ENSDART00000146929 Nonsense 546 554 15 15
Genomic Location:
Chromosome 19 (position 18754796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATTACTACAATGGAAAAGGCATCAAGCCCAAAGGCCTGTCAGACTA[T/G]GAGTCTTCCAGGGCTTTTAGTCCCTGAGCTACGCAAAGCCATATAGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m25c05h7