si:ch73-74h11.1

Ensembl ID:
ENSDARG00000062750
ZFIN ID:
ZDB-GENE-091204-215
Human Orthologues:
DSG1, DSG2, DSG3, DSG4
Human Descriptions:
desmoglein 1 [Source:HGNC Symbol;Acc:3048]
desmoglein 2 [Source:HGNC Symbol;Acc:3049]
desmoglein 3 [Source:HGNC Symbol;Acc:3050]
desmoglein 4 [Source:HGNC Symbol;Acc:21307]
Mouse Orthologues:
Dsg1a, Dsg1b, Dsg1c, Dsg2, Dsg3, Dsg4
Mouse Descriptions:
desmoglein 1 alpha Gene [Source:MGI Symbol;Acc:MGI:94930]
desmoglein 1 beta Gene [Source:MGI Symbol;Acc:MGI:2664357]
desmoglein 1 gamma Gene [Source:MGI Symbol;Acc:MGI:2664358]
desmoglein 2 Gene [Source:MGI Symbol;Acc:MGI:1196466]
desmoglein 3 Gene [Source:MGI Symbol;Acc:MGI:99499]
desmoglein 4 Gene [Source:MGI Symbol;Acc:MGI:2661061]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13085 Essential Splice Site Available for shipment Available now
sa12536 Essential Splice Site Available for shipment Available now
sa19230 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12546 Essential Splice Site Available for shipment Available now
sa1812 Missense F2 line generated During 2017
sa43406 Nonsense Mutation detected in F1 DNA During 2017
sa10131 Nonsense Available for shipment Available now
sa12088 Nonsense Available for shipment Available now
sa8630 Essential Splice Site Mutation detected in F1 DNA During 2017
sa29325 Missense Mutation detected in F1 DNA During 2017
sa32282 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
Genomic Location (Zv9):
Chromosome 20 (position 17010378)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17070331
KASP Assay ID:
2261-4101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGACTTTATGAGAATGTAGAYTRCACAAAAGAGGAATATGTGGCAAAA[G/A]TAAGCATWAGTATTTTATGTGCGACYGAACACCTGCTGCCTGGTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
Genomic Location (Zv9):
Chromosome 20 (position 17010378)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17070331
KASP Assay ID:
2261-4101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGACTTTATGAGAATGTAGAYTRCACAAAAGAGGAATATGTGGCAAAA[G/A]TAAGCATWAGTATTTTATGTGCGACYGAACACCTGCTGCCTGGTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
Genomic Location (Zv9):
Chromosome 20 (position 17010378)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17070331
KASP Assay ID:
2261-4101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGACTTTATGAGAATGTAGACTACACAAAAGAGGAATATGTGGCAAAA[G/A]TAAGCATAAGTATTTTATGTGCGACTGAACACCTGCTGCCTGGTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
ENSDART00000091076 Essential Splice Site 27 747 1 18
ENSDART00000148312 Essential Splice Site 14 277 1 6
Genomic Location (Zv9):
Chromosome 20 (position 17010378)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17070331
KASP Assay ID:
2261-4101.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGACTTTATGAGAATGTAGAYTRCACAAAAGAGGAATATGTGGCAAAA[G/A]TAAGCATWAGTATTTTATGTGCGACYGAACACCTGCTGCCTGGTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1812
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Missense 70 747 2 18
ENSDART00000148312 Missense 57 277 2 6
Genomic Location (Zv9):
Chromosome 20 (position 17007638)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17067591
KASP Assay ID:
554-1804.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTTGTTTGTTATCAATCCTGAGAATGGTTATGTCAAAGTCACAGGTC[T/A]GCTAGACAGAGAAAAAACATCTTCATACAACGTGAGTTGTGTCCCGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Nonsense 127 747 3 18
ENSDART00000148312 Nonsense 114 277 3 6
Genomic Location (Zv9):
Chromosome 20 (position 17007374)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17067327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGATATTCAGAGAGCAAAGTGGATCTGTGAAAGAAAGCAGCAAGATT[G/T]GTGGGTTCATTTATTTATTATTTTTCTGCTCTCTGAATTATGACAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Nonsense 258 747 6 18
ENSDART00000148312 Nonsense 245 277 6 6
Genomic Location (Zv9):
Chromosome 20 (position 17006233)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17066186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGAGAATTAAAGCCCAGGACAAAGATCTGAAATTCACTGATAACTG[G/A]CTGGCAGTGTTTGACATTCWGAAAGGAAATGAAGACAATCTCWTCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Nonsense 258 747 6 18
ENSDART00000148312 Nonsense 245 277 6 6
Genomic Location (Zv9):
Chromosome 20 (position 17006233)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17066186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGAGAATTAAAGCCCAGGACAAAGATCTGAAATTCACTGATAACTG[G/A]CTGGCAGTGTTTGACATTCWGAAAGGAAATGAAGACAATCTCWTCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 291 747 7 18
ENSDART00000148312   None 277 None 6
Genomic Location (Zv9):
Chromosome 20 (position 17004258)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17064211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTATACCCGTTTTATCTTTTTCCCCATGCCTGTCTACTTTCCTGAA[G/A]CCTGTTGATTTTGAAAAGGTCAAAGAGCTGGACCTCAATTTGGTTATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Missense 583 747 12 18
ENSDART00000148312   None 277 None 6
Genomic Location (Zv9):
Chromosome 20 (position 16999009)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17058962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCCAGGATTAAGATTATCATACATACTTTGTGTTCTTTGCATTTTT[A/T]GTGGTACCGTTCCTTCTGCTCTTCTGCCAGTGTGGGACCGTGAATGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091076 Essential Splice Site 631 747 14 18
ENSDART00000148312   None 277 None 6
Genomic Location (Zv9):
Chromosome 20 (position 16996363)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 17056316
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACATAAACAATGATGGGTTAACAGAATCTGATGGCCGGATTTGGTAC[A/T]GAGAAAACACAATTTCAACGGCCAACCACCGCAACAGTGCTCTCTATTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link