scn1lab

Ensembl ID:
ENSDARG00000062744
ZFIN ID:
ZDB-GENE-060906-1
Description:
sodium channel protein type 2 subunit alpha [Source:RefSeq peptide;Acc:NP_001038360]
Human Orthologues:
SCN1A, SCN2A, SCN3A, SCN9A
Human Descriptions:
sodium channel, voltage-gated, type I, alpha subunit [Source:HGNC Symbol;Acc:10585]
sodium channel, voltage-gated, type II, alpha subunit [Source:HGNC Symbol;Acc:10588]
sodium channel, voltage-gated, type III, alpha subunit [Source:HGNC Symbol;Acc:10590]
sodium channel, voltage-gated, type IX, alpha subunit [Source:HGNC Symbol;Acc:10597]
Mouse Orthologues:
Scn1a, Scn2a1, Scn3a, Scn9a
Mouse Descriptions:
sodium channel, voltage-gated, type I, alpha Gene [Source:MGI Symbol;Acc:MGI:98246]
sodium channel, voltage-gated, type II, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:98248]
sodium channel, voltage-gated, type III, alpha Gene [Source:MGI Symbol;Acc:MGI:98249]
sodium channel, voltage-gated, type IX, alpha Gene [Source:MGI Symbol;Acc:MGI:107636]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20649 Nonsense Available for shipment Available now
sa20648 Essential Splice Site Available for shipment Available now
sa16474 Nonsense Available for shipment Available now
sa40640 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11144 Nonsense Available for shipment Available now
sa25330 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 113 1996 2 26
Genomic Location (Zv9):
Chromosome 6 (position 10212394)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10066201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGGAAGGCTATATTCCGCTTTAACGCTACGCCGGCCTTGTATATTT[T/A]GAGTCCCTTCAATCCATTAAGGAGAATCTCCATCAGGGTCCTGGTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20648
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Essential Splice Site 130 1996 2 26
Genomic Location (Zv9):
Chromosome 6 (position 10212342)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10066149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCCTTCAATCCATTAAGGAGAATCTCCATCAGGGTCCTGGTGCATTC[A/T]TATCCTTTATGAGCTGAATGGATGTATGTACGCACGTTTTCCTGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16474
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 462 1996 10 26
Genomic Location (Zv9):
Chromosome 6 (position 10197140)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10050947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTGGTTGGCAGGTTGCCGCGGCAGCAGCGACAGAGAGCGGGGAGTA[C/A]AGCGGAAGGGGGGGCCTGTCGGAGGAGAGCTCCTCTGGGGGGTCTAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Essential Splice Site 656 1996 11 26
Genomic Location (Zv9):
Chromosome 6 (position 10193968)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10047775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCGGGACATCTGTGCCAACATCACCAATTGGACGTTTGCTACCTGAG[G/A]TATTTGAGTTGGATGTAAACAAACATGTTATCTATAAGAAAACTTCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 799 1996 14 26
Genomic Location (Zv9):
Chromosome 6 (position 10186709)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10040516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATCTTCACMGCAGAGATGTGTCTGAAGGTCATTGCTCTGGATCCCTA[T/A]TATTATTTCCAAGAAGGCTGGAATATMTTTGATGGCATCATCGTGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090994 Nonsense 1185 1996 18 26
Genomic Location (Zv9):
Chromosome 6 (position 10171576)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10025383
KASP Assay ID:
554-7364.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTCAGTGCTGTCAGGTCGATGTGGAGAAGGGAAAATGGAAGAGTTG[G/A]TGGATTCTCAGGAAAACCTGCTTTATCATAGTAGAGCACAACTGGTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Dental caries: Genome-wide association scan of dental caries in the permanent dentition. (View Study)
  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link