cep290

Ensembl ID:
ENSDARG00000062727
ZFIN ID:
ZDB-GENE-041111-243
Description:
Centrosomal protein of 290 kDa [Source:UniProtKB/Swiss-Prot;Acc:P85001]
Human Orthologue:
CEP290
Human Description:
centrosomal protein 290kDa [Source:HGNC Symbol;Acc:29021]
Mouse Orthologue:
Cep290
Mouse Description:
centrosomal protein 290 Gene [Source:MGI Symbol;Acc:MGI:2384917]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38048 Nonsense Mutation detected in F1 DNA During 2016
sa6804 Nonsense Mutation detected in F1 DNA During 2016
sa38047 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38046 Nonsense Available for shipment Available now
sa38045 Nonsense Available for shipment Available now
sa11985 Nonsense Available for shipment Available now
sa13473 Nonsense Available for shipment Available now
sa39478 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1383 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 306 2439 10 52
Genomic Location (Zv9):
Chromosome 25 (position 18477655)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17893965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGAGTGGAAGAGGACGACCCAGTTATGGCTGCTGTTAATGCTAAAGTC[G/T]AGGAATGGAAGGTAAGCCTGTCTTCCGAAATTTCAGCTTTGACATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6804
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 446 2439 12 52
Genomic Location (Zv9):
Chromosome 25 (position 18464969)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17881279
KASP Assay ID:
554-5375.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGACAAAGACAAAGAACTYAATGACACCCTYAGCAGAATCCGTCTGTA[T/G]GAGTCGGTGGGTTTGTRCCTTAACACTYACTTTTATGACCACATGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Essential Splice Site 623 2439 18 52
Genomic Location (Zv9):
Chromosome 25 (position 18460143)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17876453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGTGTCAGTTGGCTGTTTTGACTGTAATGTTTATGTCTGTCCTGC[A/T]GTGAATGAAATGCTGAATGAGAATAAACAGCTGGAGCAGGGCATGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 765 2439 20 52
Genomic Location (Zv9):
Chromosome 25 (position 18454675)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17870985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCGAAGAAATGACGCCCACTAGTGCGGAGGCCATCAACGCTCTCAAT[G/T]AGTACACGGTTCAGCTCCTGCAGGTGTGTGGCAGTCCAGTATTGTGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 951 2439 24 52
Genomic Location (Zv9):
Chromosome 25 (position 18449663)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17865973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCCTAGACGTCAGTGTTCCTGCTTCCGAGCTGGAGAGAGCCAACAAA[C/T]AATACACTGAGCTCACCATCAAATACAGAAACCTCCTCCAAAAGGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1223 2439 29 52
ENSDART00000090921 Nonsense 1223 2439 29 52
Genomic Location (Zv9):
Chromosome 25 (position 18443399)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17859709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCRCAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/A]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCRAGGCAGGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13473
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1223 2439 29 52
ENSDART00000090921 Nonsense 1223 2439 29 52
Genomic Location (Zv9):
Chromosome 25 (position 18443399)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17859709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCRCAAACACACGTCTGCAGAAACTGGAGGCGCAGAAGCTCCGTGACGAA[C/T]AAAAACTGGATGAGCAACAGCAGGCACTCTGGCACGCRAGGCAGGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Essential Splice Site 1463 2439 33 52
Genomic Location (Zv9):
Chromosome 25 (position 18441417)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17857727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTTCTCCTTTAAGGGTGTCTCAAAAGCATTTTCTTTTTCTCTGAGCA[G/T]AAGCTAAAAGAAAAGGAAGCTGCTTTATGGTCATCAGAACAGAATGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090921 Nonsense 1844 2439 38 52
Genomic Location (Zv9):
Chromosome 25 (position 18437783)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17854093
KASP Assay ID:
554-1295.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACTTGAATGAGCTGAAGAAGAAGATTCAGAGGCTCAGCAGTGGCCTA[C/T]AGGTCAAATGCATTTTTCTTTTTTTTTTTGCAGTCCCTNGTACTGTGAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link