dennd4a

Ensembl ID:
ENSDARG00000062721
ZFIN ID:
ZDB-GENE-060503-285
Description:
C-myc promoter-binding protein [Source:RefSeq peptide;Acc:NP_001074458]
Human Orthologue:
DENND4A
Human Description:
DENN/MADD domain containing 4A [Source:HGNC Symbol;Acc:24321]
Mouse Orthologue:
Dennd4a
Mouse Description:
DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43085 Nonsense Mutation detected in F1 DNA During 2017
sa43084 Nonsense Mutation detected in F1 DNA During 2017
sa12574 Nonsense Available for shipment Available now
sa43083 Nonsense Mutation detected in F1 DNA During 2017
sa36626 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 513 1714 10 29
ENSDART00000090962 Nonsense 513 1674 10 28
ENSDART00000129591 Nonsense 513 1724 10 30
Genomic Location (Zv9):
Chromosome 18 (position 18866289)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19096512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAGCGCAGATCCCTGACCTGGAAGATCCTGCCAAGAAAAGCCTGT[A/T]AACATCTGATCAACACCCTCAGCAATCTCCACCAGCAACTGGATGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 811 1714 16 29
ENSDART00000090962 Nonsense 811 1674 16 28
ENSDART00000129591 Nonsense 820 1724 17 30
Genomic Location (Zv9):
Chromosome 18 (position 18852569)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19082792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGATTTTGTGTTTAACGGTTTGTTTCTGGCCCTCTGGAGGTGTG[T/A]TATCGAGTGCTGATGCAGCTGTGTGGGCAATACGGTCAACCTGTTCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 885 1714 17 29
ENSDART00000090962 Nonsense 885 1674 17 28
ENSDART00000129591 Nonsense 894 1724 18 30
Genomic Location (Zv9):
Chromosome 18 (position 18849414)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19079637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTGGGGAAAGCTGAGAAATGTKGTCCGGGGTGTGGTGCTGTTCAAA[C/T]AAGTATGGAGGAGGCAGACCACCCACCCSAAAKACACTCATCTTTCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 890 1714 17 29
ENSDART00000090962 Nonsense 890 1674 17 28
ENSDART00000129591 Nonsense 899 1724 18 30
Genomic Location (Zv9):
Chromosome 18 (position 18849399)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19079622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAATGTGGTCCGGGGTGTGGTGCTGTTCAAACAAGTATGGAGGAGG[C/T]AGACCACCCACCCGAAAGACACTCATCTTTCTGGTAAAACCCCCAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090922 Nonsense 963 1714 19 29
ENSDART00000090962 Nonsense 922 1674 18 28
ENSDART00000129591 Nonsense 972 1724 20 30
Genomic Location (Zv9):
Chromosome 18 (position 18841887)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19072110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGGGCTACGACTCTCTGTCTAAAGAGGAGGTGAGGTTTGGTGGAGGT[G/T]AAGAGCAGAACTCCTCTCCAGACATCAAGGAGAAGAAGGACAGAGACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link