si:dkey-18f22.3

Ensembl ID:
ENSDARG00000062720
ZFIN ID:
ZDB-GENE-091116-32
Human Orthologue:
PCDH1
Human Description:
protocadherin 1 [Source:HGNC Symbol;Acc:8655]
Mouse Orthologue:
Pcdh1
Mouse Description:
protocadherin 1 Gene [Source:MGI Symbol;Acc:MGI:104692]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15672 Nonsense Available for shipment Available now
sa38793 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091004 Nonsense 214 1190 1 4
ENSDART00000139733 Nonsense 214 1190 2 5

The following transcripts of ENSDARG00000062720 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21127382)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21088796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGGGAAGCCTTGATCGAGAGCTGAAAGACTCATACGACCTCACCATC[A/T]AAGCTGTGGATGGAGGAAATCCACCTCGCTATAGCAGTGCCTTGCTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091004 Nonsense 928 1190 2 4
ENSDART00000139733 Nonsense 928 1190 3 5

The following transcripts of ENSDARG00000062720 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 21124663)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21086077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGCCTCTGACATATCCGCCTGGAAGCCCTGACCTGGGCAGGCACTA[T/A]CGTTCCAATTCCCCATTGCCCTCCATCCAGCTCCAGGCCCAGTCCCCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Myopia (pathological): A genome-wide meta-analysis identifies two novel loci associated with high myopia in the Han Chinese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link