si:ch211-220d9.5

Ensembl ID:
ENSDARG00000062707
ZFIN ID:
ZDB-GENE-081104-181
Description:
Novel protein similar to H.sapiens PLAT, plasminogen activator, tissue (PLAT) [Source:UniProtKB/TrEM
Human Orthologue:
PLAT
Human Description:
plasminogen activator, tissue [Source:HGNC Symbol;Acc:9051]
Mouse Orthologue:
Plat
Mouse Description:
plasminogen activator, tissue Gene [Source:MGI Symbol;Acc:MGI:97610]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17358 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090925 Essential Splice Site 21 578 None 14
ENSDART00000147275 Essential Splice Site 21 578 None 15
Genomic Location (Zv9):
Chromosome 8 (position 2464423)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 2230812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACCTGCTGCTGCTTCTGTCTGCTCTGAGCTGTGCTGCAGATCCCACAG[T/C]AAGTGTGTGTGNNNNNNNNTGTGNNNNNNNNNNCGTGTGAGAGATWTATATCAGTGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link